CellBase
Page tree
Skip to end of metadata
Go to start of metadata

You are viewing an old version of this page. View the current version.

Compare with Current View Page History

« Previous Version 2 Next »

Under construction

The variant annotation tool is integrated within the CellBase code and can be accessed in two different ways.

Using the RESTful web services

Both GET and POST annotation web services are available. These web services can be accessed by either building and accessing the appropriate URL or by using provided Java/Python clients.

The URL for accessing the GET web service can be built as: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/rest/v3/hsapiens/genomic/variant/<VARIANTLIST>/annotation, <VARIANTLIST> containing a comma-separated list of the variants to query. For example, the URL for getting the annotation of variants

chr: 19 pos: 45411941 ref: T alt: C
chr: 14 pos: 38679764 ref: - alt: GATCTGAGAAGGGAAAAAGGG

querying current stable CellBase at the University of Cambridge would be: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/rest/v3/hsapiens/genomic/variant/19:45411941:T:C,14:38679764:-:GATCTGAGAAGGGAAAAAGGG/annotation

POST queries can also be issued by using almost the same URL: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/rest/v3/hsapiens/genomic/variant/full_annotation and providing the list of comma separated variants within the data entity.

  • Using the command line interface (CLI):
  • No labels