Under construction |
The variant annotation tool is integrated within the CellBase code and can be accessed in a number of different ways.
Please, check the github Readme (https://github.com/opencb/cellbase) to learn how to compile the CellBase code.
Once compiled, you can use the variant-annotation command provided within the cellbase.sh CLI:
cellbase$ build/bin/cellbase.sh variant-annotation -h Usage: cellbase.sh variant-annotation [options] Options: -a, --assembly STRING Name of the assembly, if empty the first assembly in configuration.json will be read --batch-size INT Number of variants per batch [200] --chromosomes STRING Comma separated list (no empty spaces in between) of chromosomes to annotate. One may use this parameter only when the --input-variation-collection flag is activated. Variants from all chromosomes will be annotated by default. E.g.: 1,22,X,Y -C, --config STRING CellBase configuration.json file. Have a look at cellbase/cellbase-core/src/main/resources/configuration.json for an example --custom-file STRING String with a comma separated list (no spaces in between) of files with custom annotation to be included during the annotation process. File format must be VCF. For example: file1.vcf,file2.vcf --custom-file-fields STRING String containing a colon separated list (no spaces in between) of field lists which indicate the info fields to be taken from each VCF file. For example: field1File1,field2File1:field1File2,field3File2 --custom-file-id STRING String with a comma separated list (no spaces in between) of short identifiers for each custom file. For example: fileId1,fileId2 --exclude STRING Comma separated list of annotators to be excluded --gzip Whether the output file is gzipped [false] -h, --help Display this help and exit [false] --include STRING Comma separated list of annotators to be included -i, --input-file STRING Input file with the data file to be annotated --input-variation-collection Input will be a local installation of theCellBase variation collection. Connection details must be properly specified at a configuration.json file [false] -l, --local Database credentials for local annotation are read from configuration.json file [false] -L, --log-level STRING Set the logging level, accepted values are: debug, info, warn, error and fatal [info] -t, --num-threads INT Number of threads to be used for loading [4] * -o, --output STRING Output file/directory where annotations will be saved. Set here a directory if flag "--input-variation-collection" is activated (see below). Set a file name otherwise. --output-format STRING Variant annotation output format. Values: JSON, PB, VEP [JSON] --remote-url STRING The URL of CellBase REST web services, this has no effect if --local is present [bioinfo.hpc.cam.ac.uk:80/cellbase/webservices/rest] --resume Whether we resume annotation or overwrite the annotation in the output file [false] * -s, --species STRING Name of the species to be downloaded, valid format include 'Homo sapiens' or 'hsapiens' [Homo sapiens] --variant STRING A comma separated variant list in the format chr:pos:ref:alt, ie. 1:451941:A:T,19:45411941:T:C -v, --verbose BOOLEAN [Deprecated] Set the level of the logging [false] |
A typical run of the variant annotator would use default values for most of parameters. For example:
cellbase$ build/bin/cellbase.sh variant-annotation -i /tmp/test.vcf.gz -o /tmp/test.json.gz --species hsapiens --assembly GRCh37 |
By default, the variant annotator will call remote web services deployed at the University of Cambridge (http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/). If a local installation of the CellBase database is available, the --local flag can be enabled to improve annotation performance; please, check the github readme (https://github.com/opencb/cellbase) to learn how to build the code and point it to a particular local database.
In many occassions, variant annotation users want to complement core CellBase annotation with custom annotations either from own generated files or other resources not currently integrated in CellBase database. Thus, the variant annotation command line allows the user can specify a set of files with custom annotation data. Currently, only VCF files are allowed as custom input. Any attribute value in the INFO field can be used during the annotation process.
Three parameters in the command line control custom annotation behaviour:
--custom-file STRING String with a comma separated list (no spaces in between) of files with custom annotation to be included during the annotation process. File format must be VCF. For example: file1.vcf,file2.vcf --custom-file-fields STRING String containing a colon separated list (no spaces in between) of field lists which indicate the info fields to be taken from each VCF file. For example: field1File1,field2File1:field1File2,field3File2 --custom-file-id STRING String with a comma separated list (no spaces in between) of short identifiers for each custom file. For example: fileId1,fileId2 |
A variant-annotation command including three custom files will look like:
$ cellbase$ build/bin/cellbase.sh variant-annotation -i /tmp/test.vcf.gz \ -o /tmp/test.json.gz \ --species hsapiens \ --assembly GRCh37 \ --custom-file /tmp/file1.vcf,/tmp/file2.vcf,/tmp/file3.vcf \ --custom-file-fields AF,DP:AF,DP:AF,DP --custom-file-id file1,file2,file3 |
In this example, three files (file1.vcf, file2.vcf, file3.vcf) will be used as a source of custom annotation. Values of the AF and DP attributes will be the annotation data taken from the three files. Finally, labels `file1`, `file2`, `file3` will identify the file from which each AF and DP value were read from.
If annotating with custom files, the first step run by the `variant-annotation` command will consist of creating a RocksDB database per custom file. RocksDB (rocksdb.org) is a high performance key-value store which has shown to be extremely useful for this kind of use-case. Thus, each database will contain one entry for each variant in the VCF; the key being a variant id and the value the corresponding AF value. The RocksDB index path will share the prefix with the custom file and will end in `.idx`. In our example, three RocksDB indexes would be created:
/tmp/file1.vcf.idx /tmp/file2.vcf.idx /tmp/file3.vcf.idx |
It is important to note that these indexes need to be created just once. Posterior runs of the variant-annotation command using any of these custom files wont need to re-index them and will directly read from the index. Please, also note, that if the INFO attributes to be used vary, these indexes must be manually removed from the filesystem to force the variant-annotation tool to re-index the three files with the new attributes.
During the annotation process, the annotator will merge core annotation coming from the Mongo queries to the main CellBase database, with these custom annotations coming from queries to the RocksDB indexes. Both annotation results will be integrated into VariantAnnotation objects (https://github.com/opencb/biodata/blob/develop/biodata-models/src/main/avro/variantAnnotation.avdl). Custom annotations will be stored within the additionalAttributes field, looking like this:
{ "names": [], "chromosome": "1", "start": 10428, "reference": "", "alternate": "C", "studies": [ ... ], "type": "INDEL", "annotation": { "chromosome": "1", "start": 10428, "reference": "", "alternate": "C", "displayConsequenceType": "2KB_upstream_variant", "consequenceTypes": [ ... ], "additionalAttributes": { "file1": { "attribute": { "AF": "0.82", "DP": "4" } }, "file2": { "attribute": { "AF": "0.32", "DP": "42" } }, "file3": { "attribute": { "AF": "0.2", "DP": "14" } } } }, "end": 10427, "strand": "+", "hgvs": {}, "length": 1 } |
A wrapper method is implemented within the VariantClient object for performing variant annotation. Thus, variant annotation can be carried out by simply calling this "get_annotation" method:
>>> from pycellbase.cbconfig import ConfigClient >>> from pycellbase.cbclient import CellBaseClient >>> cbc = CellBaseClient(cc) >>> result = variant_client.get_annotation("19:45411941:T:C,1:69585:TGAGGTCGATAGTTTTTA:-,14:38679764:-:GATCTGAGAAGNGGAANANAAGGG,19:33167329:AC:TT,22:16328960-16344095:<CN5>,22:16328960-16344095:<CN1>,22:16328960-16344095:<CNV>,22:16328960-16344095:<DEL>,22:16328960-16344095:<DUP>,22:16328960-16344095:<INV>") >>> len(result) 10 >>> result[8]["result"][0] {u'alternate': u'<DUP>', u'chromosome': u'22', u'consequenceTypes': [{u'biotype': u'unprocessed_pseudogene', u'ensemblGeneId': u'ENSG00000234381', u'ensemblTranscriptId': u'ENST00000435410', u'geneName': u'MED15P7', u'sequenceOntologyTerms': [{u'accession': u'SO:0001889', u'name': u'transcript_amplification'}], u'strand': u'+', u'transcriptAnnotationFlags': [u'basic']}, {u'biotype': u'unprocessed_pseudogene', u'ensemblGeneId': u'ENSG00000224435', u'ensemblTranscriptId': u'ENST00000426025', u'geneName': u'NF1P6', u'sequenceOntologyTerms': [{u'accession': u'SO:0001636', u'name': u'2KB_upstream_variant'}], u'strand': u'+', u'transcriptAnnotationFlags': [u'basic']}, {u'sequenceOntologyTerms': [{u'accession': u'SO:0001566', u'name': u'regulatory_region_variant'}]}], ... ... ... >>> result[8]["result"][0]["consequenceTypes"] [{u'biotype': u'unprocessed_pseudogene', u'ensemblGeneId': u'ENSG00000234381', u'ensemblTranscriptId': u'ENST00000435410', u'geneName': u'MED15P7', u'sequenceOntologyTerms': [{u'accession': u'SO:0001889', u'name': u'transcript_amplification'}], u'strand': u'+', u'transcriptAnnotationFlags': [u'basic']}, {u'biotype': u'unprocessed_pseudogene', u'ensemblGeneId': u'ENSG00000224435', u'ensemblTranscriptId': u'ENST00000426025', u'geneName': u'NF1P6', u'sequenceOntologyTerms': [{u'accession': u'SO:0001636', u'name': u'2KB_upstream_variant'}], u'strand': u'+', u'transcriptAnnotationFlags': [u'basic']}, {u'sequenceOntologyTerms': [{u'accession': u'SO:0001566', u'name': u'regulatory_region_variant'}]}] |
As with any other method offered by the client, additional query parameters can be passed to refine the annotation, e.g. include, exclude, etc. Available parameters can be found in the Swagger documentation: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices
Note that a normalize parameter can be activated enabling, for example, to provide reference and alternate strings in a VCF-like format.
The best way to use of the RESTful Web Services is through the client libraries implemented for different programming languages. Nevertheless, under certain circumstances it may be required to directly access the RESTful API.
Both GET and POST annotation web services are available. These web services can be accessed by either building and accessing the appropriate URL or by using provided Java/Python/R/JavaScript clients.
The URL for accessing the GET web service can be built as: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/rest/v4/hsapiens/genomic/variant/<VARIANTLIST>/annotation
, <VARIANTLIST>
containing a comma-separated list of the variants to query. For example, the URL for getting the annotation of variants
chr: 19 pos: 45411941 ref: T alt: C
chr: 14 pos: 38679764 ref: - alt: GATCTGAGAAGGGAAAAAGGG
querying current stable CellBase at the University of Cambridge would be: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/rest/v4/hsapiens/genomic/variant/19:45411941:T:C,14:38679764:-:GATCTGAGAAGGGAAAAAGGG/annotation
POST queries can also be issued by using almost the same URL: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/rest/v3/hsapiens/genomic/variant/full_annotation
and providing the list of comma separated variants within the data entity.