Under construction |
The variant annotation tool is integrated within the CellBase code and can be accessed in a number of different ways.
Please, check the github Readme (https://github.com/opencb/cellbase) to learn how to compile the CellBase code.
Once compiled, you can use the variant-annotation command provided within the cellbase.sh CLI:
cellbase$ build/bin/cellbase.sh variant-annotation -h Usage: cellbase.sh variant-annotation [options] Options: -a, --assembly STRING Name of the assembly, if empty the first assembly in configuration.json will be read --batch-size INT Number of variants per batch [200] --chromosomes STRING Comma separated list (no empty spaces in between) of chromosomes to annotate. One may use this parameter only when the --input-variation-collection flag is activated. Variants from all chromosomes will be annotated by default. E.g.: 1,22,X,Y -C, --config STRING CellBase configuration.json file. Have a look at cellbase/cellbase-core/src/main/resources/configuration.json for an example --custom-file STRING String with a comma separated list (no spaces in between) of files with custom annotation to be included during the annotation process. File format must be VCF. For example: file1.vcf,file2.vcf --custom-file-fields STRING String containing a colon separated list (no spaces in between) of field lists which indicate the info fields to be taken from each VCF file. For example: field1File1,field2File1:field1File2,field3File2 --custom-file-id STRING String with a comma separated list (no spaces in between) of short identifiers for each custom file. For example: fileId1,fileId2 --exclude STRING Comma separated list of annotators to be excluded --gzip Whether the output file is gzipped [false] -h, --help Display this help and exit [false] --include STRING Comma separated list of annotators to be included -i, --input-file STRING Input file with the data file to be annotated --input-variation-collection Input will be a local installation of theCellBase variation collection. Connection details must be properly specified at a configuration.json file [false] -l, --local Database credentials for local annotation are read from configuration.json file [false] -L, --log-level STRING Set the logging level, accepted values are: debug, info, warn, error and fatal [info] -t, --num-threads INT Number of threads to be used for loading [4] * -o, --output STRING Output file/directory where annotations will be saved. Set here a directory if flag "--input-variation-collection" is activated (see below). Set a file name otherwise. --output-format STRING Variant annotation output format. Values: JSON, PB, VEP [JSON] --remote-url STRING The URL of CellBase REST web services, this has no effect if --local is present [bioinfo.hpc.cam.ac.uk:80/cellbase/webservices/rest] --resume Whether we resume annotation or overwrite the annotation in the output file [false] * -s, --species STRING Name of the species to be downloaded, valid format include 'Homo sapiens' or 'hsapiens' [Homo sapiens] --variant STRING A comma separated variant list in the format chr:pos:ref:alt, ie. 1:451941:A:T,19:45411941:T:C -v, --verbose BOOLEAN [Deprecated] Set the level of the logging [false] |
A typical run of the variant annotator would use default values for most of parameters. For example:
cellbase$ build/bin/cellbase.sh variant-annotation -i /tmp/test.vcf.gz -o /tmp/test.json.gz --species hsapiens --assembly GRCh37 |
By default, the variant annotator will call remote web services deployed at the University of Cambridge (http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/). If a local installation of the CellBase database is available, the --local flag can be enabled to improve annotation performance; please, check the github readme (https://github.com/opencb/cellbase) to learn how to build the code and point it to a particular local database.
A wrapper method is implemented within the VariantClient object for performing variant annotation. Thus, variant annotation can be carried out by simply calling this "get_annotation" method:
>>> from pycellbase.cbconfig import ConfigClient >>> from pycellbase.cbclient import CellBaseClient >>> cbc = CellBaseClient(cc) >>> result = variant_client.get_annotation("19:45411941:T:C,1:69585:TGAGGTCGATAGTTTTTA:-,14:38679764:-:GATCTGAGAAGNGGAANANAAGGG,19:33167329:AC:TT,22:16328960-16344095:<CN5>,22:16328960-16344095:<CN1>,22:16328960-16344095:<CNV>,22:16328960-16344095:<DEL>,22:16328960-16344095:<DUP>,22:16328960-16344095:<INV>") >>> len(result) 10 >>> result[8]["result"][0] {u'alternate': u'<DUP>', u'chromosome': u'22', u'consequenceTypes': [{u'biotype': u'unprocessed_pseudogene', u'ensemblGeneId': u'ENSG00000234381', u'ensemblTranscriptId': u'ENST00000435410', u'geneName': u'MED15P7', u'sequenceOntologyTerms': [{u'accession': u'SO:0001889', u'name': u'transcript_amplification'}], u'strand': u'+', u'transcriptAnnotationFlags': [u'basic']}, {u'biotype': u'unprocessed_pseudogene', u'ensemblGeneId': u'ENSG00000224435', u'ensemblTranscriptId': u'ENST00000426025', u'geneName': u'NF1P6', u'sequenceOntologyTerms': [{u'accession': u'SO:0001636', u'name': u'2KB_upstream_variant'}], u'strand': u'+', u'transcriptAnnotationFlags': [u'basic']}, {u'sequenceOntologyTerms': [{u'accession': u'SO:0001566', u'name': u'regulatory_region_variant'}]}], ... ... ... >>> result[8]["result"][0]["consequenceTypes"] [{u'biotype': u'unprocessed_pseudogene', u'ensemblGeneId': u'ENSG00000234381', u'ensemblTranscriptId': u'ENST00000435410', u'geneName': u'MED15P7', u'sequenceOntologyTerms': [{u'accession': u'SO:0001889', u'name': u'transcript_amplification'}], u'strand': u'+', u'transcriptAnnotationFlags': [u'basic']}, {u'biotype': u'unprocessed_pseudogene', u'ensemblGeneId': u'ENSG00000224435', u'ensemblTranscriptId': u'ENST00000426025', u'geneName': u'NF1P6', u'sequenceOntologyTerms': [{u'accession': u'SO:0001636', u'name': u'2KB_upstream_variant'}], u'strand': u'+', u'transcriptAnnotationFlags': [u'basic']}, {u'sequenceOntologyTerms': [{u'accession': u'SO:0001566', u'name': u'regulatory_region_variant'}]}] |
As with any other method offered by the client, additional query parameters can be passed to refine the annotation, e.g. include, exclude, etc. Available parameters can be found in the Swagger documentation: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices
Note that a normalize parameter can be activated enabling, for example, to provide reference and alternate strings in a VCF-like format.
The best way to use of the RESTful Web Services is through the client libraries implemented for different programming languages. Nevertheless, under certain circumstances it may be required to directly access the RESTful API.
Both GET and POST annotation web services are available. These web services can be accessed by either building and accessing the appropriate URL or by using provided Java/Python/R/JavaScript clients.
The URL for accessing the GET web service can be built as: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/rest/v4/hsapiens/genomic/variant/<VARIANTLIST>/annotation
, <VARIANTLIST>
containing a comma-separated list of the variants to query. For example, the URL for getting the annotation of variants
chr: 19 pos: 45411941 ref: T alt: C
chr: 14 pos: 38679764 ref: - alt: GATCTGAGAAGGGAAAAAGGG
querying current stable CellBase at the University of Cambridge would be: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/rest/v4/hsapiens/genomic/variant/19:45411941:T:C,14:38679764:-:GATCTGAGAAGGGAAAAAGGG/annotation
POST queries can also be issued by using almost the same URL: http://bioinfo.hpc.cam.ac.uk/cellbase/webservices/rest/v3/hsapiens/genomic/variant/full_annotation
and providing the list of comma separated variants within the data entity.